Words similar to dpn
Example sentences for: dpn
How can you use “dpn” in a sentence? Here are some example sentences to help you improve your vocabulary:
After 2 hours at 37°C, the reactions were stopped by heating to 80°C for 20 minutes and the reactions Bfa I, Dpn I and Rsa I as well as Dde I, Alu I and Hinf I were pooled, respectively.
In a second step, the plasmids were digested with restriction enzymes recognizing 4 bp sequences (Alu I, Bfa I, Dde I Dpn I, Hinf I, or Rsa I) in six separate reactions (Fig.
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.
fingerprint MCP-2, Bfa I, Hinf I, Rsa I, Dpn I, Dde I, Alu I) CTAGN 177-181 GANTCN 90-94 GTACN 3-7 GATCN 41-45 CTNAGN 123-127 AGCT were derived from the restriction fingerprints.
83 bp; Dpn I: 245.
Loading...