Words similar to devoid

Example sentences for: devoid

How can you use “devoid” in a sentence? Here are some example sentences to help you improve your vocabulary:

To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.
In the bladder, a relatively strong MIF staining was observed in the basal and intermediate layers of the urothelium of male and female rats confirming and extending our recent findings in male rats [ 10 11 ] . The superficial layer of the urothelium, on the other hand, contained relatively weak staining and areas devoid of MIF staining were often encountered.
Professor Honey, an English linguist now on assignment in Bophuthatswana, one of the less easily pronounceable places in the world, writes in a straightforward, simple, casual, friendly style totally devoid of the off-putting symbols and technical jargon that usually mark writing on pronunciation.
Americans don't gossip about it, pollsters don't poll about it, pundits don't pund about it, the torrent of Nexis articles has dried to a trickle, and even the mythical Washington dinner party is devoid of impeachment talk.
1A) were conspicuously devoid of any polymerase activity (Fig.