Example sentences for: ctggagacccacgacctggcctgccgttg

How can you use “ctggagacccacgacctggcctgccgttg” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • cDNA was resuspended in 20 ul water and used in a 30-cycle PCR reaction with 1 uM of each of the following four primers: {CCACGCTGTTTTGACCTCCATAGAAGACAC, CACATAGTCCCCCAGAAAGAGGTAGTTGCT}, in which product only forms from 6His-HA-PP1α cDNA, and {GACGCGGGCAAGCAGTCCCTCGAGACCATTGCCTGCTG, CTGGAGACCCACGACCTGGCCTGCCGTTG}, in which product only forms from endogenous PP1α cDNA.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast