Words similar to corresponding
Example sentences for: corresponding
How can you use “corresponding” in a sentence? Here are some example sentences to help you improve your vocabulary:
Reference samples for PBMC consisted of corresponding material for each experiment obtained before IL-2 exposure.
ECFP/EYFP fluorescence changes with respect to time for regions of interest corresponding to an area of Golgi membrane were determined by calculating the F t /F 0 , where F t is the background- and bleach-corrected ECFP or EYFP fluorescence at time = t and F 0 is the background-corrected ECFP or EYFP fluorescence at time = 0 s.
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
For example, a given pair of signals corresponding to measurements for one sequence (e.g.
Corresponding percentages women free of the disease at age 50 are slightly lower, 2.5%, 4.1%, 4.4%, and for 4.5%.