Words similar to corresponded

Example sentences for: corresponded

How can you use “corresponded” in a sentence? Here are some example sentences to help you improve your vocabulary:

The sequence of the anti-mPLD2 oligonucleotide was 5'-CAUGUGCAACUGGCUGGAGUUCAGA-3' and corresponded to the sequence of mouse PLD2 cDNA (GeneBank accession number U87557) starting at position 180.
In our matrix A' each row corresponded to a different gene and each column corresponded to one of 17 different conditions.
The second largest group of overlapping word pairs corresponded to the RRPE core, which is 10 nucleotides long, along with some flanking conserved bases.
2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of
The predicted secondary structure [ 22] corresponded perfectly with that of the barrel domain of the classic PRC-H proteins.