Words similar to consisting
Example sentences for: consisting
How can you use “consisting” in a sentence? Here are some example sentences to help you improve your vocabulary:
Through our genomic analysis we were able to determine that TMOD2 and 4, like TMOD1/Tmod1, share conserved genomic structures consisting of nine coding exons and a single 5' UTR exon (E0).
PCR was done to amplify the resultant cDNAs using the GeneRacer 5' primer and a primer consisting of bases immediately upstream of the translation start site of the p27 Kip1gene (CTTTCTCCCGGGTCTGCACGACCG for human and CTTCCTCCTCGGGCGGGTGT for mouse).
The work of the task forces was supported by the Legal Services Response Team, consisting of the directors of the legal services programs and directors of the Bar Foundation and Bar Association.
In fiscal year 2000, IRS implemented a senior executive performance management system that aligned the executives' performance expectations with a set of balanced expectations consisting of employee satisfaction, customer satisfaction, and business results, and with two additional areas of responsibility-leadership and equal employment opportunity.
These lyrics have been composed by a committee consisting of, in the French original, Alain Boublil and Jean-Marc Natel, with the addition, for the English version, of Herbert Kretzmer, aided by James Fenton--this last person being a first-rate poet and arts critic, well known to readers of the New York Review of Books . From this assemblage has come more lyrics than you would think possible in an evening's entertainment--wordy rhyming couplets pouring outward from the stage in a ceaseless gush, until you feel you have been drenched (as you will see, if you click ).
Loading...