Example sentences for: cgggaccaccttatgttatttcatcatg

How can you use “cgggaccaccttatgttatttcatcatg” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • PCR amplification was performed using primers Pry1 (CCTTAGCATGTCCGTGGGGTTTGAAT) and IR (CGGGACCACCTTATGTTATTTCATCATG) located in the 3' P end.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast