Example sentences for: cctctttgtgactatgtggactgatgtcgg

How can you use “cctctttgtgactatgtggactgatgtcgg” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • A 750 bp control band was produced by amplification from the endogenous PrP gene using PrP-S and the reverse primer (PrP-AS: 5' CCTCTTTGTGACTATGTGGACTGATGTCGG 3').


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast