Words similar to ccgggtagatccgcccctgactggtgattggtcggtgggcgggcag
Example sentences for: ccgggtagatccgcccctgactggtgattggtcggtgggcgggcag
How can you use “ccgggtagatccgcccctgactggtgattggtcggtgggcgggcag” in a sentence? Here are some example sentences to help you improve your vocabulary:
The oligo corresponding to nucleotides -100 to -59 of RAR α promoter (antisense strand: 5' TCGACTGCCCGCCCACCGACCAATCACCAGTCAGGGGCGGATCTAC 3'; sense strand: 5' CCGGGTAGATCCGCCCCTGACTGGTGATTGGTCGGTGGGCGGGCAG 3') [ 17 ] was synthesized by the New Jersey Medical School Molecular Resource Facility.