Example sentences for: ccgggtagatccgcccctgactggtgattggtcggtgggcgggcag

How can you use “ccgggtagatccgcccctgactggtgattggtcggtgggcgggcag” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The oligo corresponding to nucleotides -100 to -59 of RAR α promoter (antisense strand: 5' TCGACTGCCCGCCCACCGACCAATCACCAGTCAGGGGCGGATCTAC 3'; sense strand: 5' CCGGGTAGATCCGCCCCTGACTGGTGATTGGTCGGTGGGCGGGCAG 3') [ 17 ] was synthesized by the New Jersey Medical School Molecular Resource Facility.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast