Words similar to cas
Example sentences for: cas
How can you use “cas” in a sentence? Here are some example sentences to help you improve your vocabulary:
The Cas SD has two sets of potential SH2 interacting tyrosines, the N-terminal subdomain containing 4 YQXP motifs located between a.a.
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
Subsequently, in all our experiments reported, we used chimeras of the Cas SD fused to the C-terminus of the Src kinase domains.
Beatrice Knudsen, Weill Medical College of Cornell University, NY, NY); anti-FAK and anti-Cas (Transduction Laboratories, Lexington, KY).
We also verified that the tyrosine phosphorylated Cas chimera could affect the ability of v-crk to activate the JNK pathway in transient transfection experiments (Fig.