Words similar to carrying
Example sentences for: carrying
How can you use “carrying” in a sentence? Here are some example sentences to help you improve your vocabulary:
DNA carrying the wildtype syk coding region was generated by polymerase chain reaction (PCR) using high fidelity polymerase (Perkin Elmer, Branchburg, NJ) forward- 5'gacacctgccgaggtgtgtg 3'and reverse 5'gagggaggtggctgacaatc 3'primers, and random-primed cDNA template derived from the human Burkitt's lymphoma cell line, Daudi.
Mutations on the X chromosome were first recombined with MS1096 and interactions were tested in females by crossing MS1096/Y;UAS-mCul1/TM3 males to virgin females carrying the mutation and MS1096 over a balancer.
A black-and-white photograph briefly recalls happier times, then makes way for this young professional (she's wearing the mandatory blue suit) describing her grandmother's degeneration, her increasing frailty and the consequent reversal of roles: "I had to carry her and hold her as I remember her always carrying me."
Chromosome-size DNA was prepared from yeast transformants carrying circular YACs, separated by clamped homogeneous electrical field gel electrophoresis (CHEF), transferred onto a nylon membrane, and hybridized with an alphoid DNA probe or Alu -probe (see above).
Two bronze lions, carrying out feng shui principles, guard its doors.
Loading...