Example sentences for: burkitt

How can you use “burkitt” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Five μgs of human embryonic kidney or Burkitt's lymphoma total RNA (Ambion, Inc., Austin, TX) were added to a reaction mix in a final volume of 12 μl, containing 0.5 pmol T7-(dT) 24 oligonucleotide primer.

  • Although Figure 2Band 2Cshow that increases in signal intensity are not linear for all probe sequences, median slide intensity across sets of duplicate hybridizations for two different tissues (human embryonic kidney and Burkitt's lymphoma) increased an average of 40% +/- 7% and 99% +/- 6% for the 1:1 DAP:A and all DAP conditions, respectively, over the unmodified control sample.

  • For example, consider Dennis Burkitt's report on jaw tumors in African children, Alfred Blalock's initial efforts in cardiac surgery, or, more recently, Starzl and colleagues' observations, in a small collection of patients, of donor leukocyte chimerism, whereby recipients acquire tolerance to foreign donor cells.

  • DNA carrying the wildtype syk coding region was generated by polymerase chain reaction (PCR) using high fidelity polymerase (Perkin Elmer, Branchburg, NJ) forward- 5'gacacctgccgaggtgtgtg 3'and reverse 5'gagggaggtggctgacaatc 3'primers, and random-primed cDNA template derived from the human Burkitt's lymphoma cell line, Daudi.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast