Words similar to bp
Example sentences for: bp
How can you use “bp” in a sentence? Here are some example sentences to help you improve your vocabulary:
Three potential transcription factor binding sites - CCAAT, κE2, and Ets - were previously identified by database sequence comparison in the 43 bp region described above (StuI to HincII) [ 25].
51 bp; Bfa I: 531.
To make pBS1, the oligonucleotides 5'ACCTCCCAAACTATAGATTGGGTG 3'and 5'CGGCCAGAGTCGACTCACATATTG 3'were used to amplify a 1370 bp fragment from pTU23.
Two of them, pVC-SV211 and pVC-SV60, contain a 130-bp mouse B1 element as a common hook and, respectively, 211 bp and 60 bp of the trangene-specific targeting hooks.
In the sur2 clone, the amino-terminal 970 bp of the 1128 bp Rv0365c ORF is fused to 14 bp from the pYUB178 vector to generate an ORF encoding 328 amino acids (aa), compared to 376 aa encoded by the full-length Rv0365c ORF.
Loading...