Example sentences for: bp

How can you use “bp” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The sizes of the products were: PdL(3)3E36 ( Red herring/encore ) 534 bp; PdL(2)4G14 ( VhaSFD ) 465 bp; PdL(3)2C33 ( Sugar baby ) 464 bp; PdL(3)8S64 ( filamin ) 362 bp; PdL(3)8S25 ( fwd ) 345 bp; PdL(3)8R128 ( Cct1 ) 298 bp.

  • The limit of detection of our semi-nested RT-PCR assay with primers OL26, OL27 and JWA-1b is in the range of 1.3 TCID 50 /filter, yielding a clearly visible 292 bp band.

  • CDR3 lengths varied between 15 and 45 bp (mean, 32 bp).

  • BP1 expression in breast tumor tissues

  • A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast