Words similar to atgtcaacacccacagcagcagat

Example sentences for: atgtcaacacccacagcagcagat

How can you use “atgtcaacacccacagcagcagat” in a sentence? Here are some example sentences to help you improve your vocabulary:

Saccharomyces cerevisiae genomic DNA was used as template in a polymerase chain reaction (PCR) with PPT1 -specific oligonucleotide primers, (5' primer, 5'-ATGtcaacacccacagcagcagat; 3' primer, 5'-CTAtaaaccaaaaccaccattagaa) that contained initiation and stop codons, respectively.