Words similar to ataatgtgtgtagccaagtggggt

Example sentences for: ataatgtgtgtagccaagtggggt

How can you use “ataatgtgtgtagccaagtggggt” in a sentence? Here are some example sentences to help you improve your vocabulary:

Plasmids pB32 and pB86, carrying H109A and H109D alleles of HNT2 , were constructed by site-directed mutagenesis [ 49 ] of plasmid pB05 using primers PB3 (5'ATAATGTGTGTAGCCAAGTGGGGT) and PB4 (5'TAATGTGTGTATCCAAGTGGGGTAC).