Words similar to against
- aga
- agac
- agacacaatcgactgaagg-
- agacuugaggucggucaacguguac-
- agaete
- agaggaagacactgttgagtag
- agaggtgctggtgccaac
- again
- again--to
- again--trouble
- again--without
- again-it
- againand
- against
- against--is
- against-the-odds
- again—
- agambiae
- agame
- agamemnon
- agamenmon
- agammaglobulinemia
- agapemone
- agar
- agat
- agatcc
- agatcccaggggtctgtgaaaatggagtgt-
- agatct
- agatctgattctaaccatatcgagtgg
- agrunt
- agtx
Example sentences for: against
How can you use “against” in a sentence? Here are some example sentences to help you improve your vocabulary:
We extracted the 1 Mb interval from the November 2002 human genome assembly and performed a sequence-similarity search against the entire human genome (build 31 (Figure 4) and the non-redundant nucleotide (NT) and high throughput genomic sequence (HTGS) databases (data not shown)) using MEGABLAST.
He also ordered Secretary Rumsfeld to develop a military plan against the Taliban.
as a test against which to estimate" the likely effects of multiculturalism.
Reviewing dictionaries of this kind--those similar in content and purpose to what are called “college” or “desk” dictionaries in the US--is probably quite useless in providing guidance to potential purchasers: there is always the temptation to carp at omissions, cavil at what are seen as infelicities in defining and other information, and argue one's case against the theories that are reflected in the organization of the text.
I am not, however, in a position to decide whether the odd $5 bill given by Mr. Johnson out of his own pocket should be lumped with that money belonging to other people that he would spend--or whether it would entitle him to compete against Bill Gates' $27 million in the Slate 60 rankings.
Loading...