Words similar to aacctctccattcagc
Example sentences for: aacctctccattcagc
How can you use “aacctctccattcagc” in a sentence? Here are some example sentences to help you improve your vocabulary:
The clones were: Clone T/F 1-471 bp of 7.194 Kb cDNA [using primers T 5' GGTCTCAACTTAAACTCCAGCACCACGA 3' with the primer F] and clone G/A 246-2007 bp of 7.194 Kb cDNA [using primer G 5' GAGAAGGTGGAG AACCTCTCCATTCAGC 3' with primer A].
Loading...