Words similar to aaacgacggccagtgaattgtaatacgactcactataggg

Example sentences for: aaacgacggccagtgaattgtaatacgactcactataggg

How can you use “aaacgacggccagtgaattgtaatacgactcactataggg” in a sentence? Here are some example sentences to help you improve your vocabulary:

Reverse transcription was carried out in a 20 μl volume containing 1 μg total RNA, 1 μg oligdT25- T7 (5'-AAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGG -CGATT-3') primer, 1 μg template switch primer (5'-AAGCAGTGGTAACAACGC -AGGGACCGGG-3'), 4 μl first-strand reaction buffer, 2 μl 10 mM dithiothreitol (DTT; Gibco-BRL) 1 μl 10 mM dNTPs, 1 μl SUPERase-in, (Amtion, Austin, TX) and 200 u Superscript II reverse transcriptase (Gibco- BRL).