Words similar to paired

Example sentences for: paired

How can you use “paired” in a sentence? Here are some example sentences to help you improve your vocabulary:

In a seperate reaction, sense primer 5'GGAGAAGTCTGTGATCGCCAAGAAGCTGGA3' was paired with antisense primer (nt 3100 to nt 3081).
5 environment than in the DM250 environment (paired t-test, t s = 6.37, df = 11, p < .001).
We think that, in some cases, the paired availability design would be well suited for this type of evaluation.
Indeed, mean fitness in LB was significantly lower than that in the control environment (paired t-test, t s = 12.
As well, some pairs predicted in the earlier structure models were removed from subsequent models due to the large number of exceptions to the positional covariation at the two paired positions.