Example sentences for: paired

How can you use “paired” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • [8] on odor space in honeybees in this issue is an excellent example of how behavioral studies can be paired with neurobiological data to access the perceptual space of an animal.

  • A skin air sac model was used to compare the virulence of isolate CS101 and paired isogenic mutants [ 9 ] . Briefly an air- and liquid-tight connective tissue pouch was generated on the back of female, six week old, outbred CD1 mice (Charles River, Portage, MI) by slow dermal injection of 0.9 mL of air via an 0.4 mm needle on a 1.0 mL syringe.

  • The paired availability design (PAD) is a method for combining data from various before-and-after studies that adjusts for different fraction receiving the intervention in a manner similar to that for nonattendance and contamination [ 25 ] . For applications to screening, PAD requires a well-defined geographic region in which screening has been introduced, with little in- or -out- migration and no other changes over time that would affect the endpoint of cancer mortality.

  • In a seperate reaction, sense primer 5'GGAGAAGTCTGTGATCGCCAAGAAGCTGGA3' was paired with antisense primer (nt 3100 to nt 3081).

  • Using improved WGS sequence-assembly algorithms, two additional assemblies of just the WGS plasmid and BAC paired end sequences used in WGS1 were generated in March 2001 (WGS2) and July 2002 (WGS3), roughly coinciding with the WGS assemblies of the human [ 3] and mouse genomes [ 4], respectively.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast