Example sentences for: accaggacgatcaactgggcttc

How can you use “accaggacgatcaactgggcttc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The probe for exon 2 of the VhaSFD gene was generated using primers VhaFWD (CCAGCTGATCCTTCAGGAACTGC) and VhaREV (ACCAGGACGATCAACTGGGCTTC).

How many words do you know? Try our free vocabulary size test!


Search for example sentences

Loading Loading...