Example sentences for: pdl

How can you use “pdl” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • When flies are fed doxycycline, rtTA binds to target sequences in the synthetic tet-on promoter in the PdL P element.

  • DNA was transferred to a Southern blot and hybridized with a radiolabeled 172 bp fragment from the 3' P end of PdL . This probe fragment was generated by PCR amplification with primers located within the 3' P end, IRREV (ATGATGAAATAACATAAGGTGGTCCCG) and P3MCSREV (ATGAGTTAATTCAAACCCCACGGACAT).

  • PdL caused the expression of a pair of approximately 1.4 kb transcripts that contain a 44 amino acid ORF identified by the Drosophila genome project as CG14975 , as determined by northern blot with a CG14975 probe.

  • Line PdL(3)2C33 contains an insert at the 5' end of a gene with homology to a maltose permease from Bacillus stearothermophilus [ 37], which was named Sugar baby (Figure 3c).

  • It is difficult to estimate the number of genes that were tested in the PdL screen, but it is certain to have been only a tiny fraction of the genome.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast