Example sentences for: pct

How can you use “pct” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • On the basis of their findings, the investigators concluded that PCT, CRP, white blood cell and body temperature does not discriminate SIRS from sepsis, and PCT was the only parameter to discriminate between sepsis and severe sepsis [ 9].

  • To assess the diagnostic value of PCT, IL-6, IL-8 and standard measures for identifying critically ill patients with SIRS and suspected sepsis, prospective measurements were taken in 78 consecutive patients admitted with acute SIRS and suspected infection.

  • Here we have shown that the RNA triphosphatases Pct1 and CaCet1 are essential for viability of S. pombe and C. albicans, respectively The conclusion that CaCet1 is essential is based on a finding that none of the 54 independent isolates in the single-transformation test were homozygous for cacet1Δ; our interpretation is consistent with criteria established by Mitchell and colleagues for inference of essentiality using this genetic approach.

  • PCT appears to be a useful early marker for discriminating between SIRS and sepsis

  • 2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast