Words similar to pce
Example sentences for: pce
How can you use “pce” in a sentence? Here are some example sentences to help you improve your vocabulary:
S. pombe RNA triphosphatase Pct1 is a 303-amino acid polypeptide with a homodimeric quaternary structure [ 12 ] . The pct1 +gene contains a single intron within the open reading frame [ 12 ] . S. pombe RNA guanylyltransferase Pce1 is a 402-amino acid monomeric protein [ 20 ] ; there are no introns within the pce1 +gene.
Genomic DNA was prepared from individual isolates and the integration of the pct1::kanMX or pce1::kanMX cassettes into the correct locus was tested by PCR using diagnostic primers.
We used a modified version of the long flanking homology PCR technique [ 17 ] to produce pct1Δ and pce1Δ gene disruption cassettes in which the open reading frames were replaced by the kanMX gene.
2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of