Example sentences for: pce

How can you use “pce” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The intron-less pce1 +gene was amplified from plasmid pl32-PCE1 [ 12 ] . The PCR products were digested with Xho I and Bam HI and then inserted into the S. pombe expression vector pREP41X ( LEU2 ars1 +) [ 19 ] . The inserts were sequenced to exclude the acquisition of unwanted mutations during the amplification and cloning steps.

  • S. pombe RNA triphosphatase Pct1 is a 303-amino acid polypeptide with a homodimeric quaternary structure [ 12 ] . The pct1 +gene contains a single intron within the open reading frame [ 12 ] . S. pombe RNA guanylyltransferase Pce1 is a 402-amino acid monomeric protein [ 20 ] ; there are no introns within the pce1 +gene.

  • 2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of

  • We suspect that expression levels of the Pct1 or Pce1 enzymes in these strains exceeded a threshold required for cell viability.

  • The pce1::kanMX cassette was excised from PCE1Δ by digestion with Aat II and Nde I. The cassette fragments were gel-purified and then used to transform diploid S. pombe.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast