Words similar to ags
- agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle
- agreements
- agricultural
- agriculture
- agris
- agrobacterium
- agrobacteriumbinary
- agrocin
- agronomic
- agronomy
- agrp
- ags
- agsim
- agt
- agtacg
- agtactagggtagctcctcc-
- agtcaggaatggctgcacc-
- agttgaggggactttcccaggc-
- agttggttttcctttggctgtgtg
- agttgtgtttgtgtccgacg
- agua
- aguada
- aguadilla
- aguadulce
- aguas
- aguideforevaluatingagencies
- aguideforfederalagenciesin
- agva
- ah
- ah-to-nym
- aha
Example sentences for: ags
How can you use “ags” in a sentence? Here are some example sentences to help you improve your vocabulary:
But somehow, more federal activism has only spurred the litigious exuberance of the 50 AGs.
Ascorbate would remain more effective, rather than being the weakest of the antioxidants studied to limit apoptosis (in AGS cells).
In contrast, the MTT assay did not reveal changes in cell number in response to hydrogen peroxide in either AGS or IEC-18 cells (Tables 2and 3).
Using the media release of BrdU-labeled DNA as an index of early necrotic cell death, it was observed that peroxynitrite treatment induced necrosis in AGS cells (P < 0.001).
Cells (AGS or IEC-18) were seeded into 96-well plates (1.
Loading...