Words similar to active
- actgtg
- actgtggctactcagctgtg-
- acth
- action
- actions
- activated
- activates
- activating
- activation
- activations
- activationâ
- activator
- activators
- activats
- active
- active-control
- active-controlled
- active-duty
- active-site
- actively
- activeperl
- actives
- activestate
- activex
- activities
- activity
- activity-based
- actr
- actttggatcattctatgcag
Example sentences for: active
How can you use “active” in a sentence? Here are some example sentences to help you improve your vocabulary:
We also ran database searches using the PHI-BLAST program that combines a regular BLAST search with a pattern search [ 60 ] . In these searches, the active site motif was used as the pattern query, and various RDRP sequences as the sequence queries.
"The Fray," our reader forum, is active 24 hours a day, seven days a week.
cDNA clones were from three, non-normalized cDNA libraries: a mixture of adult tissue (projects 707 and 945, W23 inbred line with active Mutator transposons), 4-day-old roots (project 614, W23 inbred line), and immature ears (project 606, Oh43 inbred line).
The biggest impact was seen in active recreation, health, socializing, and participation in organizations.
Moreover, the active surveillance team asks for additional patient information which is not present on routine passive reporting forms.
Loading...