Example sentences for: acctcccaaactatagattgggtg

How can you use “acctcccaaactatagattgggtg” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • To make pBS1, the oligonucleotides 5'ACCTCCCAAACTATAGATTGGGTG 3'and 5'CGGCCAGAGTCGACTCACATATTG 3'were used to amplify a 1370 bp fragment from pTU23.

How many words do you know? Try our free vocabulary size test!


Search for example sentences

Loading Loading...