Example sentences for: acacagataagttgctggcc

How can you use “acacagataagttgctggcc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The only product generated by upstream (5'-CTTCTATCGCCTTCTTGACG) and downstream (5'-ACACAGATAAGTTGCTGGCC) primers was of the predicted size (529 bp).

How many words do you know? Try our free vocabulary size test!


Search for example sentences

Loading Loading...