Example sentences for: a-atp

How can you use “a-atp” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The cyclic reinvasion model for long term persistence of a selfish genetic element through homing [ 38 ] suggests that the small Thermoplasma intein evolved through reduction from a large endonuclease containing intein similar to the one found in the pyrococcal A-ATPase.

  • The A-ATPase and the V-ATPase inteins are located in the most conserved part of the host gene.

  • The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).

  • Autocatalytic splicing of the T. acidophilum A-ATPase catalytic subunit occurs efficiently in the E. coli cytoplasm.

  • The small intein in the Thermoplasma A-ATPase is closely related to the endonuclease containing intein in the Pyrococcus A-ATPase.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast