Example sentences for: a-atp

How can you use “a-atp” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The cyclic reinvasion model for long term persistence of a selfish genetic element through homing [ 38 ] suggests that the small Thermoplasma intein evolved through reduction from a large endonuclease containing intein similar to the one found in the pyrococcal A-ATPase.

  • The A-ATPase and the V-ATPase inteins are located in the most conserved part of the host gene.

  • Phylogenies constructed with the host protein (A-ATPase catalytic subunit) and with 16S rRNA do not group these two organisms together, suggesting that the A-ATPase intein spread through horizontal gene transfer.

  • The structure of the bovine mitochondrial F 1 -ATPase has been determined by X-ray crystallography [ 30 ] . The intein insertion points in the yeasts' V-ATPase and the Thermoplasma and Pyrococcus A-ATPases correspond to the catalytic site where the ATP binds and is hydrolyzed during the catalytic cycle.

  • The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast