Example sentences for: a-atp

How can you use “a-atp” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • These primers match the coding sequence of the Thermoplasma acidophilum A-ATPase A subunit (gene identification number 9369337) and introduce restriction sites useful in subcloning.

  • The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG).

  • Here we present data on the cloning and expression of the T. acidophilum A-ATPase A subunit in E. coli, and we discuss implications for the location, propagation and distribution of inteins among organisms.

  • The small intein in the Thermoplasma A-ATPase is closely related to the endonuclease containing intein in the Pyrococcus A-ATPase.

  • The other two major differences in codon usage between the T. acidophilum A-ATPase A subunit and E. coli are AGG (Arg) and AGA (Arg) which are present in T. acidophilum A-ATPase A subunit at frequencies of 41 and 16 per 1000 respectively.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast